Table 2 Primer sets used for the 16S rRNA gene quantification of A. muciniphila , F. prausnitzii , Enterobacteriaceae , Clostridium cluster IV, Bifidobacterium and Entospletinib in vivo Lactobacillus group by qPCR. Amplicon size, annealing and
fluorescence acquisition temperature are also reported Target microorganism Primer set Sequence (5′ to 3′) Product size (bp) Annealing temp (°C) Fluorescence acquisition temp (°C) Reference Akkermansia muciniphila AM1 CAGCACGTGAAGGTGGGGAC 349 63 88 [31] AM2 CCTTGCGGTTGGCTTCAGAT Faecalibacterium prausnitzii Fprau223F GATGGCCTCGCGTCCGATTAG 199 67 85 [32] Fprau420R CCGAAGACCTTCTTCCTCC Evofosfamide research buy Enterobacteriaceae Eco1457F CATTGACGTTACCCGCAGAAGAAG 195 63 87 [32] Eco1652R CTCTACGAGACTCAAGCTTGC Clostridium
Cl_IV S-*-Clos-0561-a-S-17 TTACTGGGTGTAAAGGG 588 60 85 [33] S-*-Clept-1129.a-A-17 TAGAGTGCTCTTGCGTA Bifidobacterium bif-164 GGGTGGTAATGCCGGATG 523 60 90 [34] bif-662 CCACCGTTACACCGGGAA Lactobacillus group Lac1 AGCAGTAGGGAATCTTCCA 327 61 85 [35] Lac2 ATTYCACCGCTACACATG Results Faecal microbiota profile of atopic children and healthy controls The faecal microbiota of 19 atopic children and 12 healthy controls living in Italy was characterized by means of the HTF-Microbi.Array platform (Additional files 4 and 5) [24]. Hybridization experiments were performed in two replicates. Pearson’s correlation OSI-906 in vivo coefficients ranging from 0.95 and 0.99 were achieved between the two replicates, proving the high reproducibility of the phylogenetic profiles obtained by the HTF-Microbi.Array platform. A PCA of the fluorescence signals from atopics and controls was carried out.
The diagnosis of atopy was considered as a dummy environmental variable. As shown in Figure 1A, the principal components Chloroambucil PC2 and PC3, which collectively represented only a minor fraction of the total variance (9.7%), resulted in the separation of samples according to the health status. In order to identify the bacterial lineages showing differences in abundance between atopics and controls, probe fluorescence signals obtained from the HTF-Microbi.Array in atopics and controls were compared by box plot analysis (Additional file 6). Probes showing P < 0.3 are represented in Figure 1B. Atopic children showed a tendency towards reduction of A. muciniphila F. prausnitzii et rel. and Ruminococcus bromii et rel. (Clostridium cluster IV), and Clostridium cluster XIVa, and were enriched in Enterobacteriaceae Bacillus clausii and Veillonella parvula. Figure 1 Analysis of the HTF-Microbi.Array fluorescence signals. A: PCA of the HTF-Microbi.Array fluorescence signals. Atopy or health status were considered as dummy environmental variables (green triangles) and indicated as atopic and control, respectively.