The spectra were normalized to the total ion current intensity in the m/z range over 2000–50,000 to modulate peak dimension. The peaks ranging between m/z 0 and m/z 2000 were eliminated

from analysis to avoid the interference of adducts, artefacts of the energy-absorbing molecules and other possible chemical contaminants. Biomarker Wizard Version 3.1 (BMW; Ciphergen) was used to identify corresponding peaks in each spectrum (peak clusters). The settings for autodetect peaks to cluster were as follows: signal-to-noise ratio was 5 and minimum peak threshold was 0% for the first pass; for cluster completion, cluster mass window was 0.3%, and signal-to-noise ratio for the second pass was 2. Also, BMW helps pick out differently expressed Tigecycline mw peaks by evaluating the differences of peak intensities between groups by non-parametric Kruskal–Wallis test and Mann–Whitney test [23, 24]. Peak intensities were considered statistically significantly different at P-values below 0.05. Construction of classification tree model.  Construction of the selleck classification tree model was based on a platform of bioinformatic, Biomarker Patterns Software Version 5.0 (BPS; Ciphergen), which was developed basing on the Classification

and Regression Trees decision tree system [25]. The BPS helps build a binary decision tree algorithm with the peak information of the training set, and that algorithm assigns each sample into one of the two nodes according to some rules established by the intensity of certain peaks [16–19]. Interleukin-2 receptor The data of differently expressed peaks generated by BMW between active TB and non-TB group were used in this proceeding. The BPS generated some classification tree models and evaluated the

error cost (represented as ‘relative cost’ in BPS) for each one. Of those models, the one with the lowest error cost was the best, and then this resulting model was applied to the data of the test set for evaluating the efficiency of classification. The spectra of 178 serum samples were detected by MALDI-TOF MS combined with WCX magnetic beads. This combination was particularly effective in resolving low molecular weight proteins and peptides, as shown in Fig. 1. Peak of m/z 48 was found differently expressed between active TB group and non-TB group (Table 2). Reproducibility was evaluated by performing an 8-spot assay (intra-assay), a 20-chip assay (interassay) and a 20-day assay with a mixed serum sample (age and sex matched, two patients with TB and two health volunteers), and the coefficient of variations for peak intensity of spectra were 1.7%, 1.9% and 13.3%, respectively. These data derived from averaging values for nine of the highest amplitude peaks as follows: m/z 4309, 4963, 5344, 7772, 7846, 8058, 8608, 9413 and 16105.

2a). The characteristics of the serum antibody’s viral membrane proteins, production of which was stimulated by peptide immunization, were confirmed by western blot analysis. VP2 and VP1 peptide immunized serum surprisingly detected CVB3 capsid protein in CVB3 infected HeLa cell lysates (Fig. 2b). This finding confirmed production of specific antibodies to the synthetic peptide. Enzyme-linked immunosorbent assay verified detection of viral IgG antibodies to VP2 and VP1 peptides.

Because CVB3-infected mice produced an anti-viral antibody, the sera of mice infected Pritelivir cost with coxsackievirus can be used to detect CVB3 immunized antibody. Sera were collected on Days 3, 7, 14, 21 from mice that had been infected with CVB3 virus and then added to each peptide in coated 96-well plates and reaction with the antibodies confirmed. Both peptides identified viral antibodies in the sera. Anti-viral IgG antibody was dramatically increased depending

on virus infection time. Thus, virus IgG antibodies could be detected by the new synthetic peptide (Fig. 3). The VP2 peptide showed better sensitivity than did the VP1 peptide. Therefore, the VP2 peptide was used in the experiments for detecting CVB3 antibody in human serum. Collection of patient samples for this experiment was approved by the Institutional Review Board of Samsung Medical Center. All experiments were performed according to the approved experimental protocol. Sera of patients who had been diagnosed with were used. Viral capsid protein was detected by immunohistochemistry in a heart biopsy of a patient with fulminant myocarditis (Fig. Rapamycin cost 4a, cAMP iii) and not in heart biopsy sample from a patient with non-viral DCMP (Fig. 4a, i) or one who had not been treated with entero-VP1 antibody (Fig. 4a, ii). The OD value of virus IgG antibody in serum increased with time after infection, similarly to what was found in the mouse sera experiment. However, the increase in virus IgG was not

as great as that in the mouse experiment (Fig. 4b). This finding suggests that the synthetic VP2 peptide might be used to detect viral antibody that is produced in response to CVB3 infection. In the future, we expect that this method will be accepted for diagnosis of infection with enterovirus and CVB3 in humans. In this study, we developed a rapid and accurate CVB3 system for detecting viral infection in sera of patients with myocarditis. For this CVB3 antibody detection system, we synthesized new peptide sequences that recognize the anti-CVB3 antibody produced during viral infection. We selected these peptide sequences by predicting the antigenicity and hydrophobicity of regions in the whole enterovirus capsid protein sequence. We confirmed that the synthesized peptides induced antibody production by rabbit immunization tests. The new synthetic peptides significantly recognized CVB3-induced antibodies in mouse sera.

The function of NK cells was also improved as shown by an increase in IFN-γ secretion and cytotoxic activity against an HPV+ cell line. This crosstalk between NK cells and DCs needed CD40 interaction and IL-12p70 secretion, whereas NKG2D was not implicated. Our results provide insight into how VLPs interact with innate immune cells and how NK cells and DCs play a role in the immune response induced by this vaccine agent. “
“Citation Sharma D, Singh A, Trivedi SS, Bhattacharjee J. Role of endothelin and inflammatory cytokines in pre-eclampsia – a pilot north Indian study. Am J Reprod Immunol 2011; 65: 428–432 Problem  Pre-eclampsia is new onset hypertension

during pregnancy with proteinuria. The initiating event in pre-eclampsia is postulated to involve reduced Everolimus molecular weight placental perfusion, which leads

to widespread dysfunction of the maternal vascular endothelium. Cytokines also appear to contribute to the development of the pathological condition. The aim of this study was to evaluate the role of cytokines in pre-eclampsia and to study the relationship between endothelin-1 and cytokines with the severity of the disease. Method of study  This cross-sectional study included 300 women with pre-eclampsia and 200 healthy pregnant women. Their blood samples were analyzed for endothelin-1 and inflammatory cytokines. Results  Increased endothelin-1 and cytokines [tumor necrosis factor-α, interleukin-2 (IL-2) and γ-interferon (IFN-γ)] levels were found in pre-eclampsia (P < 0.001). Significant positive correlation was seen between endothelin-1 and cytokine level (IL-2 beta-catenin activation and IFNγ) in the pre-eclamptic group (P = 0.001). Conclusion  We conclude that pre-eclampsia is associated with increased levels of both endothelin-1 and circulating inflammatory cytokines, which points toward the role of endothelial and inflammatory components. “
“Research on infectious diseases Y 27632 using animal models has been a successful example of translational research. However, because chronic infections are

still one of the main causes of death and disability in the world, it is expected that a great number of mice will continue to be used to address this subject. Although increasing awareness regarding animal welfare has led to novel recommendations for animal housing enrichment, studies evaluating the impact of these modifications on the immune response to infection are lacking. The present study shows that validated and recommended simple environmental enrichment does not interfere with the immune response to chronic infection with Mycobacterium avium for up to 20 weeks, as assessed by the bacterial load in the spleen and lung, by the number and activation status of the main cell populations of the immune system and the serum concentration of interferon-gamma. Therefore, enrichment can be encouraged without concern regarding comparability of results among laboratories studying this type of chronic infections.

ucsc.edu/cgi-bin/hgGateway) with selected tracks from ENCODE [20] and GEO databases (naïve CD4+ and Th1 cells: GSE26550, [21]; BMDM: GSE33802 [22]. (B) Analysis of relative resistance to MNase. Data normalized to control MNase-digested genomic DNA and b-actin are shown as mean ± SD of two experiments. Figure S8. Methylation status of TNF promoter in mouse T cells and bone marrow-derived macrophages DNA was isolated from mouse ES cells, embryonic fibroblasts (MEF),

BMDM and various T cells, demethylated by Imprint DNA Modification Kit (Sigma-Aldrich) according to the manufacturer’s instructions and used as template for PCR with primers for amplification of the proximal (forward TGGGTTAGTGAGTGAAAGGGATA, reverse AAATTTCAATTCTCAAAATCCTATACA) and distal (forward GGAATGAATTTAGTTTTGGGAATT, reverse AAATAAACTAAAAAAATCCATCCAAA) parts of mouse TNF promoter. Amplified DNA fragments, LY2606368 in vivo corresponding to proximal (CpG sites from -255 to +7) and distal (CpG sites from -849 to -670) TNF promoter regions were cloned to TOPO TA Cloning® Kit for Sequencing

(Invitrogen, Carlsbad, CA, USA) and sequenced with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Austin, TX, USA). From two to nine individual clones were analyzed. Stimulated cells were treated 3 hours with 4 μg/ml of anti-CD3 and 1 μg/ml of anti-CD28 antibodies (αCD3/αCD28) or 10 ng/ml of PMA and 1 μg/ml of Ionomycin (P/I). Figure S9. Binding of NFkB family members to the regulatory elements of the TNF/LT

VX-765 solubility dmso locus in bone marrow derived macrophages (BMDM) and dendritic Urease cells (BMDC) ChIP-Seq analysis of mouse bone-marrow derived macrophages (GSE16723 [23]) (A) and dendritic cells (GSE36099 [24]) (B) Figure S10. Control of efficiency of T cell polarization T cells were isolated and polarized as described in Materials and Methods and Supporting Information Table 4. Th0s, Th2s and Th17s cells were polarized in the presence of soluble anti-CD3 antibodies; Th0i, Th1i and Th2i cells were polarized in the presence of immobilized anti-CD3 antibodies. Cells were stimulated by 10 ng/ml PMA and 1 μg/ml Ionomycin for 4 hours in the presence of 5 μg/ml of Brefeldin A and fixed for at least 30 min with 2% paraformaldehyde in PBS. Further washing and staining steps were performed in PBS/BSA/EDTA buffer supplemented with 0.5% Saponin. Cells were analyzed on a FACSCalibur, FACS-Canto or Fortessa (BD Biosciences, Franklin Lakes, NJ, USA) flow cytometers using CellQuest (BD Biosciences) and FlowJo 7.6 (Tree Star, Inc., Ashland, OR, USA) software. Data shown are representative of five experiments. “
“The type III secretion system (T3SS) plays a key role in the exertion of full virulence by Bordetella bronchiseptica. However, little is known about the environmental stimuli that induce expression of T3SS genes.

Lymphatic reabsorption also may contribute to UFF, and we previously reported that lymphangiogenesis is linked to PF. But it is not clear yet whether lymphangiogenesis is a common finding in PF and peritonitis. Methods: We developed the two animal models: the rat chlorhexidine gluconate (CG) model and the rat methylglyoxal (MGO) model by intraperitoneal injections of CG or MGO solutions. We evaluated lymphatic vessel proliferation selleck chemicals llc and the expression of vascular endothelial growth factor (VEGF)-C and -D in their parietal peritoneum and diaphragm by immunohistochemistry (IHC) and real-time PCR. To analyze the lymphatic

function in the two models, we evaluated the amount of FITC in serum after intraperitoneal injection of FITC-dextran. Results: Both the CG model rats and the MGO model rats showed lymphangiognesis, which is more predominant in the diaphragm than in the parietal peritoneum. In the CG model, VEGF-C and -D expression were high in the diaphragm and the parietal peritoneum. On the other hand, VEGF-D expression was mainly upregulated in the diaphragm of the MGO model, while VEGF-C, and -D expression elavated in the parietal peritoneum. In the analysis of lymphatic function, we detected Small molecule library cell assay positive levels of FITC dextran in the serum of the rats, and found the level of FITC-dextran were extremely high in both models. Conclusion: Our

results suggest that Lymphangiogenesis is a common Selleckchem Decitabine feature of PF and peritonitis, which may contribute to UFF. CHAN SIU KIM, HO YIU WING, LAM CHI KWAN, TAM CHUN HEY, TANG WING CHUN ANTHONY, WONG SZE HO SUNNY Renal Unit, United Christian Hospital, Hong Kong Introduction: The emergence

of Extended Spectrum Betalactamase (ESBL) producing enterobacteriaceae imposed great challenge in treating CAPD peritonitis. There was in fact no generally agreed treatment strategy in this issue, especially on the drug of choice, route and frequency of administration. ISPD guideline update 2010 provided dosing recommendation of Intraperitoneal (IP) Imipenen/cilastatin. In an attempt to minimize Imipenem induced neurological complication, other carbapenem group antibiotics, most notably intraperitoneal Meropenem, has been tried successfully. However the pharmacokinetics, dosing and treatment outcome have not been well studied. In this report we retrospectively analyzed the treatment outcome by various treatment strategies. Methods: Renal registry of a single centre was retrieved for the period 1 Jan 2010 to 31 Dec 2013 and all the episodes of CAPD peritonitis caused by ESBL eneterobacteriaceae were studied. Data as shown in table 1 were collected. Outcome information displayed includes need of Tenckhoff catheter (T/C) removal, relapse of the same pathogen within 28 days of completing treatment and death.

, 2001; Garn & Renz, 2007). Suppression

of Th2 and induction of Th1 cytokine production and induction of T-regulatory (Treg) cells could thus be beneficial in treating allergic diseases by antagonizing the Th2 cell development, resulting in suppressed IgE formation (Romagnani, 2004; Fink, 2010). A proposed effect of probiotics is down-regulation of the Th2 cytokine production either by stimulation of Th1 cytokines or by stimulation of the regulatory cytokine selleck IL-10, produced by antigen-presenting cells such as monocytes (Pochard et al., 2002; Niers et al., 2005; Ghadimi et al., 2008). Furthermore, the activities of Th1 and Th2 are suppressed via IL-10 and TGF-β production by Treg cells, to help in balancing the intestine (Haller et al., 2000; Pessi et selleck inhibitor al., 2000; Rautava et al., 2005; Garn & Renz, 2007). Deficiency in functional Treg cells is currently widely accepted as a possible mechanism underlying the Th2-skewed response in allergy (Larche, 2007; Akdis & Akdis, 2009). Lactobacilli can upregulate the induction of Treg cells, triggering the release of regulatory cytokines and controlling the delicate balance between Th1 and Th2 immunity as well as tolerance (Savilahti et al., 2008; de

Roock et al., 2010; Fink, 2010; Kwon et al., 2010). The differential effects of probiotic strains are frequently investigated in vitro using human peripheral blood mononuclear cell (hPBMC) but generally derived from healthy donors (Miettinen Megestrol Acetate et al., 1996; Chen et al., 1999; Kankaanpaa et al., 2003; Drouault-Holowacz et al., 2006), and only a few studies have investigated the in vitro response of probiotics to hPBMC of allergic patients (Pochard et al., 2002; Flinterman et al., 2007; Rasche et al., 2007; Ghadimi et al., 2008). Healthy subjects, in contrast to allergic individuals, are assumed to regulate the Th1/Th2 balance by inducing sufficient Treg cell activity to maintain or restore immune tolerance

to allergens (Akdis & Akdis, 2009; Fink, 2010). The aim of the present study was to investigate the immunomodulatory capacity of six selected Lactobacillus strains and one mixture of two strains on hPBMC of pollen-allergic patients. Birch- and grass pollen-allergic patients were chosen as these are common seasonal allergies, with a prevalence estimated up to 40% (D’Amato et al., 2007), and a possible benefit of probiotics could thus be of interest for a large part of the population. Human trials on probiotics have shown promising results for prevention of atopic eczema; however, the results on possible benefits for management of inhalant allergies, such as hay fever are not as conclusive (Vliagoftis et al., 2008; Kalliomaki et al., 2010).

caninum antigens

were not indicative for protection (10,41,45). small molecule library screening Assessment of i.n. vaccinated animals confirmed the earlier findings on the protection achieved with recNcPDI (19). Of course, one problem with i.n. vaccination is the restricted amount of antigen which can be administered to mice. Nevertheless, i.n vaccination of mice with the 1 μg recNcPDI antigen conferred protection against cerebral disease (90%), together with low cerebral parasite burden. Association of recNcPDI with the chitosan/alginate or chitosan/alginate-mannose nanogels may have increased this efficacy – with the antigen associated with chitosan/alginate nanogels, 100% of the mice were protected – however, the high number of protected mice with the antigen in the absence of nanogels precluded a clear indication that the nanogels had an added value. It would be necessary to perform additional studies, in which the antigen load per vaccination was titrated, to see whether the limit of inducing protective antibody is lower with nanogel-associated antigen. Nevertheless, the present work demonstrates that nanogel-associated antigen is indeed an efficacious vaccine, and the results from the i.p. vaccination suggest that the nanogels are providing an

added value to the vaccine efficacy. Moreover, quantification of cerebral infection intensities in i.n. vaccinated animals showed that nanogel delivery of the vaccine had an advantage over the nanogel-free vaccine. Although the chitosan/alginate nanogel-associated antigen appeared to be more efficacious than chitosan/alginate-mannose Ponatinib purchase nanogel-associated antigen in limiting cerebral infection compared, the differences were only slight. Others have shown that protective immune responses against experimentally induced neosporosis in acute disease mouse models have been mainly associated with the development of a Th1-type immune response, dominated by IgG2a antibody production and natural killer (NK) cell proliferation with increased IFN-γ production Morin Hydrate (51,52).

However, there are also reports on protective effects achieved by Th2-type responses in acute disease (40,42–44) and in foetal infection models (44). All these observations support the idea that both Th1 and Th2-driven immune mechanisms can limit disease, at least in the mouse model. Indeed, our own results are showing the presence of a mixed Th1/Th2 response induced in nanogel-delivered vaccine immunized mice, protected from disease, and showing reduced cerebral parasite load. To elaborate on the type of immune response (Th1 or Th2) induced, we analysed the level of cytokine mRNA transcription in splenic tissue. It is important to note that the cytokine pattern described is the combined result of immune responses to both vaccination and infection.

As with CCR7, we showed previously that the level of CD38 expression does not correlate check details with chemotaxis towards CCL19 [24]. Nevertheless, we could see that DC stimulated with bromelain

or with bromelain in combination with the cytokine cocktail without PGE2 had noticeably higher MFI values for CD38 (Fig. 2B). Addition of reduced amounts of PGE2 did not increase the MFI. Thus, PGE2 had an inhibitory effect of CD38 expression on DC, similar to IL-12p70 production. Interestingly, a correlation between CD38 expression and IL-12p70 secretion of DC has been described previously [33], in agreement with our data. The only DC population capable of producing higher amounts of IL-12p70 was DC stimulated GDC-0068 mw with bromelain in combination with the cytokine cocktail without PGE2. We expected to find a higher secretion of IL-12p70 in the group stimulated with the cytokine cocktail without PGE2, as PGE2 has been claimed to be responsible for the lack of this cytokine, but our results indicate that it is not enough to only remove PGE2. In addition to not producing any notable amounts of IL-12p70, these DC also showed a less mature phenotype compared with the other groups, so obviously PGE2 is necessary for inducing (phenotypic) maturation. However, addition of bromelain could overcome this lack of stimulation. On the other hand, bromelain alone was not potent enough to induce both phenotypic

maturation and high IL-12p70 production. The lack of IL-12p70 production was not a result of a general inability of the DC, as we detected large amounts of IL-12p70 after stimulation with the bacterial compound OK432

using DC from the same preparation [24]. Comparing the functionality of the generated DC populations in a MLR, we could show that PGE2 also influenced the T cell stimulatory capacity of the DC. When DC stimulated with the modified cytokine cocktail without PGE2 were cocultured with lymphocytes, fewer proliferative T cells were detected. Addition of ¼ of PGE2 to the cocktail improved this stimulatory capacity. This was also true regarding the phenotype of the cells. Use of ¼ of the amount Phosphatidylethanolamine N-methyltransferase of PGE2 in the cocktail increased the expression of surface maturation markers, and some markers had even higher surface expression using this stimulation than with the original cytokine cocktail. Addition of bromelain to both the original and the modified cytokine cocktail with reduced PGE2 resulted in an even more mature phenotype, but this phenotype had an insufficient secretion of IL-12p70. Because IL-12p70 is essential for a strong induction of cytotoxic T lymphocyte (CTL) responses, several other attempts to generate DC with high IL-12p70 secretion have been made by other research groups. Stimulation with polyriboinosinic polyribocytidylic acid (poly I:C) has shown to generate DC capable of producing high amounts of IL-12p70 [34, 35].

We observed also an enrichment of CD28− CD27− (and a parallel decrease of CD28+ CD27+) T cells in PBMCs from NHPs compared with HDs. The CD8αα+ T-cell subset displayed a different profile as compared FK506 order to CD8αβ+ T cells. In HDs, CD8αα+ T cells were enriched in differentiated T-cells

(particularly CD45RA+/− CCR7−) as compared to CD8αβ+ T cells. Effector memory CD8αα+ T cells expressed CD28 alone or in combination with CD27, and differentiated CD8αα+ T cells CD27 or CD28. In NHPs, CD8αα+ T cells displayed either a CD45RA+ CCR7+ or a CD45RA+ CCR7− profile. Most of the CD45RA+ CCR7± CD8αα+ T cells stained positive only for CD28. CD4+ T cells were observed within the four CD45RA+/− CCR7+/− compartments in HDs, whereas 75·5% of CD4+/− T cells from NHPs stained positive for CD45RA+ CCR7+. Similar to the phenotype of CD8+ T cells, NHP CD4+ T cells were enriched in cells expressing only CD28 and not CD27. Interestingly, CD4+/− CD8αβ+/− T cells displayed a phenotype, based on CD45RA and CCR7 expression, comparable (not statistically different) to CD4± T cells in PBMCs from HDs. Of note, CD4+ CD8αα+ selleck chemicals llc and CD4+ CD8αβ+ T cells represented the only immune cell subsets that stained positive for CD107a+ (particularly in CD45RA+ CCR7 cells expressing CD28 and or CD27): 5·5% and 3·7% of total CD4+ CD8αα+ and CD4+ CD8αβ+

T cells in HDs, and 1·3% and 1·7% in NHPs (data not shown). In HDs, most CD8αβ+ T cells and approximately 50% of CD8αα+ T cells expressed the IL-7Rα. CD4+ T cells and CD4+ CD8αα+ CD8αβ+ T cells showed an increased frequency of IL-7Rα+ T cells and higher levels of IL-7Rα expression/cell

(measured by MFI) compared with CD8+ T cells. The PBMCs obtained from NHPs showed a similar trend for IL-7Rα expression to HDs: more CD4+ T cells expressed more IL-7Rα compared with the CD8+ T-cell subsets, but the frequency of IL-7Rα+ in all T-cell subsets was decreased in PBMCs obtained from NHPs compared with the frequency observed in HDs (e.g. in 86% of CD4+ T cells in HDs and 67% in NHPs were IL-7Rα+, Fig. 2b). PDK4 The cytokine profile of CD4+, CD4+ CD8+, CD8αα+, CD8αβ+ and CD4− CD8− T cells upon PMA/ionomycin stimulation (used to induce maximal cytokine production) in NHPs (n = 27) and HDs (n = 5) was assessed. The frequency of different T-cell subsets in the medium control and upon PMA/ionomycin stimulation (Fig. 3a) was similar in PBMCs from NHPs. In HDs, the frequency of CD4− CD8− T cells upon PMA/ionomycin stimulation was increased (from 3·6% to 10%) as a result of the down-regulation of CD4 and CD8 co-receptors in the CD4+ and CD8αβ+ T-cell subsets24 (and concomitant decreased frequency of those subsets upon PMA/ionomycin stimulation as seen in some HDs). In PBMCS from NHPs and from HDs, CD4+ and CD8αα+ T cells showed similar frequencies of cytokine-producing cells in response to PMA/ionomycin stimulation.

1) with moderate Cobimetinib price interstitial inflammatory cell infiltrate and moderate tubulitis. There was also evidence of moderate peritubular capillaritis. Electron microscopy and fluorescence failed to show evidence of viral inclusions

and stains for BKV, CMV or HSV were negative. Immunofluorescence was negative for C4d. Because of concerns about rejection in the face of possible ongoing viral nephropathy and possible nephrotoxicity from cidofovir, intravenous immunoglobulin (IVIG) was administered at 1 mg/kg weekly and the cidofovir stopped. Over the following 3 days, her fever settled immediately and her creatinine, after peaking at 339 μmol/L, begun to fall sharply. By day 5 her creatinine had fallen to 175 μmol/L, she remained afebrile and her systemic malaise had improved. Her creatinine timeline and therapy as shown in Fig. 2. Discharged home for convalescence, the patient continued to receive a further 3 weekly doses of IVIG (1 mg/kg) BGB324 manufacturer and her creatinine continued to fall such that 3 weeks post biopsy the creatinine was 127 μmol/L. Adenovirus PCR remains positive in the urine and respiratory secretions however have been undetectable in the serum and plasma since the last day of cidofovir. Repeat transplant

biopsy at day 98 did not show ongoing vascular rejection or viral inclusions but there was a mild ongoing cellular Cell press infiltrate. These cases illustrate the potential severity of adenovirus infection in kidney transplant recipients, and highlight the need for consideration of adenovirus infection as a cause of fever of unknown origin in such patients. They also illustrate that disseminated adenovirus infection can present early as well as late from the time of transplantation. Both cases also illustrate the potential renal toxicity of cidofovir. Adenoviral disease is well characterized in haematopoietic stem cell transplant (HSCT) recipients, with incidence ranging from 3% to 47%.[1] Reported clinical syndromes include pneumonia, colitis, hepatitis, haemorrhagic

cystitis, tubulointerstitial nephritis and encephalitis. Disease is often disseminated, and the mortality rate for symptomatic patients approaches 26%.[2] However adenovirus is a rare pathogen in solid organ transplant recipients. In kidney transplant recipients, the most common manifestation is hemorrhagic cystitis which both of our patients presented with. A recent literature review[3] revealed 37 reported cases, 36 of which occurred within 1 year of transplantation. Thirty-four patients received high-dose steroids for treatment of symptoms of acute rejection. Four patients received antiviral medications. Disease was mild and self-limiting in all and no patient required dialysis. There was universal return of creatinine to near baseline.